Transcribe to mRNA

Published by Matt in

Transcribe the given DNA strand into corresponding mRNA - a type of RNA, that will be formed from it after transcription. DNA has the bases A, T, G and C, while RNA converts to U, A, C and G respectively.

Examples

dna_to_rna("ATTAGCGCGATATACGCGTAC") ➞ "UAAUCGCGCUAUAUGCGCAUG"

dna_to_rna("CGATATA") ➞ "GCUAUAU"

dna_to_rna("GTCATACGACGTA") ➞ "CAGUAUGCUGCAU"

Notes

  • Transcription is the process of making complementary strand.
  • A, T, G and C in DNA converts to U, A, C and G respectively, when in mRNA.
Watch a quick demo on how Edabit works.